Translate

The Translate template, located in the Templates panel, prompts you to enter a sequence and a translation table, and to choose the desired file output and location. Later, when you run the script, SeqNinja will translate the nucleic acid sequence into protein sequence using the selected translation table, then output the results to the selected file.

If the input sequence is annotated, each CDS feature will be translated separately, and any translation table and/or codon_start annotations will be honored. If the input is unannotated, or contains no CDS features, the entire sequence will be translated. Note that translation only progresses for sequences with lengths that are multiples of three (i.e., codons). An “extra” base or two at the end will not be reflected in the output.

• In the Choose Sequence(s) button row, enter the sequence you wish to translate (see Add and modify a sequence).

• In the Translation Table area, choose a table from the drop-down menu. All NCBI and Lasergene tables are available and are denoted by number and/or description. By default, SeqNinja translates using the genetic code identified in the source data (e.g., the GenBank /transl_table qualifier), if available; otherwise, it uses the standard genetic code (NCBI:1).

• Use the Reading Frame drop-down menu to choose the reading frame for the translation.
  
  
  • <Default: 1 or as annotated> directs SeqNinja to honor any existing /codon_start annotations in the input file(s); or otherwise, to begin at the first base.
    
    
  • Ignore ‘/codon_start’ annotations directs SeqNinja to begin translating at the first base and to ignore any /codon_start sequence annotations. Note that this selection is equivalent to the <Default: 1 or as annotated> selection (above) for any input sequence other than a .gbk or .seq file with /codon_start qualifiers.
    
    
  • 1, 2 and 3 direct SeqNinja to begin the translation at the first, second or third base, respectively, ignoring any /codon_start annotations. For an input sequence containing /codon_start qualifiers, selecting the start codon implicitly is similar to choosing Ignore ‘/codon_start’ annotations, but allows a specific frame to be set.

• In the Save Results As area, choose the name and location in which to save the output (see Specify output format and location).

Example:

Input sequence: GGAGTCTCCCATTGATTACA

Results are saved as Translated Sample.fasta, and the contents of the file are shown below:

GVSH.L